Monday, April 6, 2015

013-2015

MO640 - Multiple-choice question


Considering the Jukes-Cantor and Kimura Evolution Models and the three sequences below from a homologous DNA locus of different species, evaluate the statements:

Sequence 1: AATGATGACGTTAGGAAAACTAGACGGTACGTAGT
Sequence 2: AATAATGACGTTAGGAAAATTAGACAGTAGGCAGT
Sequence 3: AAAAATGACGTAAGGAAAATTAGACAGCAGGTAGT

(columns where mutations have been observed are in red)

 I - Considering the Jukes-Cantor Model, the distance between sequences 1 and 2 and between 2 and 3 are the same.
II - Considering the Kimura Evolution Model, the distance between 1 and 2 is different from the distance between 2 and 3.
III - The distance between 1 and 3 is greater than the distance between 1 and 2 and the distance between 2 and 3, no matter which of the two models is used.

Choose the correct alternative

a) Only statement I is correct.
b) Only statements I and II are correct.
c) Only statement III is correct.
d) Only statements II and III are correct.
e) None of the above.

Original idea by Mario Akita

No comments:

Post a Comment