013-2015

MO640 - Multiple-choice question

Considering the Jukes-Cantor and Kimura Evolution Models and the three sequences below from a homologous DNA locus of different species, evaluate the statements:

Sequence 1: AATGATGACGTTAGGAAAACTAGACGGTACGTAGT
Sequence 2: AATAATGACGTTAGGAAAATTAGACAGTAGGCAGT
Sequence 3: AAAAATGACGTAAGGAAAATTAGACAGCAGGTAGT

(columns where mutations have been observed are in red)

 I - Considering the Jukes-Cantor Model, the distance between sequences 1 and 2 and between 2 and 3 are the same.
II - Considering the Kimura Evolution Model, the distance between 1 and 2 is different from the distance between 2 and 3.
III - The distance between 1 and 3 is greater than the distance between 1 and 2 and the distance between 2 and 3, no matter which of the two models is used.

Choose the correct alternative

a) Only statement I is correct.
b) Only statements I and II are correct.
c) Only statement III is correct.
d) Only statements II and III are correct.
e) None of the above.

Original idea by Mario Akita

011-2006

MO640 - Multiple-choice question

What is the main difference between the Kimura model and the Jukes-Cantor model?

1) The Kimura model is used to study transitions only, while the Jukes-Cantor model is used to study transversions only.
2) The Kimura model is a recursive representation of the Jukes-Cantor model.
3) The Kimura model has a better approach than the Jukes-Cantor model, because transitions and transversions receive different probabilities.
4) Both models are used to study different subjects, so there is no ground for comparison.
5) None of the above

Original idea by: Douglas José Soares Rodrigues
Translation help by: Leandro Tacioli

044-2008

MO640 - Multiple-choice question

According to the model of DNA sequence evolution described by Kimura,
in the equation X(t) + Y(t) + 2 * Z(t) = 1, which sentence below is CORRECT?

a. Y(t) is the transition probability.
b. X(t) is the transversion probability.
c. Y(t) + 2 * Z(t) is the probability of having no changes.
d. The constant 2 multiplying Z(t) is to consider the two different transition types (i.e., A ⇆ G; C ⇆ T).
e. None of the above.

Original idea by: Helder dos Santos Ribeiro
Translation help by: Raphael Cristofaro

018-2004

MO640 - Multiple-choice question

Regarding DNA evolution models, we can say that:

1. The Jukes-Cantor model is more refined than the Kimura model, since it ignores transitions, rare in nature, and considers only transversions, which are more common mutations.
2. The Kimura model is inefficient because it has only two parameters, one for the probability of a mutation occuring, and one for the probability of the position remaining unchanged.
3. The Jukes-Cantor model is more refined than the Kimura model because it takes into consideration the variation in mutation rates in different positions along the length of the sequence.
4. The Kimura model is more refined than the Jukes-Cantor by taking into account the difference that normally exists between the transversion rate and the transition rate.
5. None of the above

Original idea by: José Augusto Amgarten Quitzau
Translate Help: Leandro José de Bortoli

019-2007

MO640 - Multiple-choice question

With respect to the Jukes-Cantor and Kimura models of DNA sequence evolution, choose the right option:

a) In molecular evolution the probability of a transition tends to be larger than the probability of a transversion.
b) The Kimura model does not consider different rates for transversions and transitions.
c) The main difference introduced by Kimura was having the same rate for different kinds of mutation.
d) The distances between two sequences, when measured using the models of Kimura and Jukes-Cantor, tend to be very different, even between almost identical sequences.
e) None of the above.

Original idea by: Luis Felipe Strano Moraes
Translation help by: Andrey Victor Justo