034-2015

MO640 - Multiple-choice question

Let b and c be the number of breakpoints and cycles, respectively, as defined by the breakpoint graph G for two genomes, with caps and disregarding common adjacencies. Consider the following cases for the DCJ operation, as defined in the original DCJ paper:

1. Cutting two black lines belonging to different cycles and then joining the extremes
2. Improper joining
3. Proper joining with nonconsecutive black lines
4. Proper joining with consecutive black lines in a cycle with two or more black lines
5. Proper joining with consecutive black lines in a 2-cycle

In which of the cases above, performing the DCJ operation would decrease c?

1. Just in I and V
2. Just in II and IV
3. Just in I, III and V
4. Just in II, III and IV
5. None of the above.

Original idea by: Juan Felipe Hernández Albarracín.

090-2008

MO640 - Multiple-choice question

Which of the following evolutionary events can be modeled by one or more applications of the double-cut-and-join operation?
I - Translocation II - Reversal III - Block Interchange

1. I, II, and III.
2. II and III only.
3. I and II only.
4. II only.
5. None of the above

Original idea by: João Paulo Pereira Zanetti

Translation help by: Cristiano Borges Cardoso

094-2008

MO640 - Multiple-choice question

Given two distinct genomes A and B, there is always a DCJ operation which reduces b - c by one unit, where b is the number of breakpoints and c is the number of cycles between A and B, as defined in the original DCJ paper. Others features of DCJ are:

a) A DCJ operation cannot increase (b - c).
b) A DCJ operation always increases the number of cycles c.
c) A DCJ operation always reduces the number of breakpoints b.
d) A DCJ operation can leave both b and c unchanged.
e) None of above.

Original idea by: Fabio L. Usberti
Translation help by: Andrey Victor Justo

053-2008

MO640 - Multiple-choice question

The table below specifies 4 species and 4 characters for them, that can undergo state changes of the form 0 -> 1 or 1-> 0. Identify the FALSE alternative for the mutations in the tree shown besides the table, using maximum parsimony criteria:

Species Characters 1 2 3 4 Alpha 1 0 0 1 Beta 0 0 1 0 Gamma 1 1 0 0 Delta 1 0 1 1

1. For character 3, just one change in this tree is enough to explain all states.
2. For character 4, just one change in this tree is enough to explain all states.
3. The total number of changes for all characters in a most parsimonious reconstruction of this tree is 5.
4. This tree is optimal for the given table.
5. None of the above.

Original idea by: Tiago Takamoto

033-2015

MO640 - Multiple-choice question

The SCJ median of the three genes bellow is:

a)

b)
 
c)
 
d)
 
e) None of the above

Original idea by: Miriam Ito

032-2015

MO640 - Multiple-choice question

Using the genomes and topology below, considering the SCJ distance, and solving the small phylogeny problem, the distance between G1, G2, G3, G4, and G5 and their parents are, respectively:
a) 3, 1, 1, 2, 0
b) 3, 1, 1, 1, 0
c) 3, 1, 1, 1, 1
d) 1, 1, 1, 1, 1
e) None Of The Above

Original idea by: Cicero Silva Luiz Júnior

031-2015

MO640 - Multiple-choice question

About SCJ rearrangement operations, consider the following statements:

I – A cut operation breaks an adjacency into two telomeres;
II – A join operation pairs two telomeres into an adjacency;
III – A join operation is the reverse of a cut operation;

Select the alternative with all the correct statements and no others:

1. II
2. III
3. I and III
4. All of the above.
5. None of the above.

Original idea by: Wesley Ide

030-2015

MO640 - Multiple-choice question

Which is the correct answer for the SCJ median of the three genomes below?

1. {Y_h Z_t   , V_h W_t}
2. {W_h X_t   , V_h W_t}
3. {Y_t Z_h   , W_t X_h}
4. {X_h W_t   , Y_h Z_t}
5. None of the above

 

Original idea by: Shagali Huanca Vargas

029-2015

MO640 - Multiple-choice question

Considering the two liner genomes below, what is the SCJ distance between them?

1) 16

2) 10

3) 8

4) 5

5) None of the above

Original idea by: Leandro Tacioli

028-2015

MO640 - Multiple-choice question

Given the definition of the Weighted Multichromosomal Genome Median Problem (WMGMP) below:

WMGMP consists in, given a set of genomes with the same gene content, finding a genome that minimizes the sum of the distances between the median and each genome of the set multiplied by its weight.

evaluate the following statements with respect to WMGMP under the SCJ distance:

I. For some instances, it is possible to find different genomes that solve this problem.
II. The median between two or more identical genomes is a genome without adjacencies.
III. Considering two or more genomes with no common adjacencies, the median between them is a set containing all the adjacencies from all the genomes.
IV. There is no known polynomial time algorithm to solve WMGMP.

and chose the true alternative:

a) Only I and IV are correct.
b) Only I and II are correct.
c) Only II and III are correct.
d) Only IV is wrong.
e) None of the above.

Original idea by: Mario Akita

027-2015

MO640 - Multiple-choice question

A necessary and sufficient condition for a given adjacency α to appear in the SCJ weighted median of n genomes, with n odd, assuming that all of them have the same weight, is for α to be present in:

1. All genomes
2. At least n - 1 genomes.
3. At least half of the genomes.
4. At least one more genome than their conflicting adjacencies.
5. None of the above.

Original idea by: Juan Felipe Hernández Albarracín

026-2015

MO640 - Multiple-choice question

Given the two genomes below, what is their SCJ distance?

A)  8
B)  10
C)  12
D)  14
E) None of the above

Original idea by: Rafael S. Padilha

059-2008

MO640 - Multiple-choice question

Mark the alternative that renders the following matrix ultrametric:

	a	b	c	d	e
a	0	2	A	1	1
b	-	0	2	B	2
c	-	-	0	1	1
d	-	-	-	0	C
e	-	-	-	-	0

1. A=1 ; B=2 ; C=1 
2. A=1 ; B=1 ; C=2
3. A=2 ; B=1 ; C=2
4. A=2 ; B=3 ; C=1
5. NDA

Original idea by: Tiago Takamoto

057-2008

MO640 - Multiple-choice question

Consider the tree with branch lengths and its corresponding distance matrix below:



Regarding the following statements:

I. The value of X in the matrix is 2,5.
II. The value of Y in the matrix is 1,5.
III. The matrix is additive.
IV. The matrix is ultrametric.

Which alternative lists exactly the true statements?

1. I, II, III, IV.
2. I, III.
3. I, III, IV.
4. II, III, IV.
5. NDA

Original idea by: Fabio L. Usberti

033-2008

MO640 - Multiple-choice question

Consider the following matrix for the computation of global similarity:

	0	A	G	T
0	0	-2	-4	-6
C	-2	0	X	-4
G	Y	-2	1	-1
T	-6	-4	-1	Z

Assuming weights for match = 1, mismatch = 0, and gap = -2, indicate the alternative below that represents the correct values of X, Y, and Z (respectively) in the matrix:

1. -1; -3; 0.
2. -1; -3; 2.
3. -2; -4; 0.
4. -2; -4; 2.
5. NDA

Original idea by: Fabio L. Usberti

028-2008

MO640 - Multiple-choice question

In the matrix used to compute the local similarity between two sequences, where do we look for this similarity value and when do we stop the construction of an optimal alignment?

1. Look for the maximum in the entire matrix. Stop alignment construction when the first line or first column is reached.
2. Look for the maximum in the entire matrix. Stop alignment construction when a zero is found.
3. Look for the maximum in the last line and last column. Stop alignment construction when position (0,0) is reached.
4. Look for the maximum in the last line and last column. Stop alignment construction when the first line or first column is reached.
5. None of the above

Original idea by: João Paulo Pereira Zanetti

025-2015

MO640 - Multiple-choice question

Consider the following two sequences:

AGTTCAGCTTCA
AACTATTCG

Review the following statements and select the alternative listing all the correct statements. Assume a scoring system with the following parameters: Match = 1, Mismatch = -1, Gap = -3.

I – There is no optimal alignment between these two sequences.
II – The similarity between these two sequences is a positive value.
III – In an optimal alignment between these two sequences, the number of gaps is equal to the number of mismatches.

1. I only
2. II only
3. III only
4. II e III only
5. None of the above.

Original idea by: Wesley Ide

024-2015

MO640 - Multiple-choice question

The set of adjacencies of the fictitious genome below is:

a) {A_tB_t, C_hD_h, D_hE_h, E_hF_h, F_hG_h}
b) {A_tB_t, C_tD_t, D_hE_t, E_hF_h, F_tG_t}
c) {A_hB_h, C_hD_h, D_hE_h, E_hF_h, F_hG_h}
d) {A_hB_h, C_tD_t, D_hE_t, E_hF_h, F_tG_t}
e) None of the above

Original idea by: Miriam Ito

023-2015

MO640 - Multiple-choice question

Suppose that just a single reversal is performed in the original genome below, where numbers indicate genes and signs indicate orientation. Which of the following alternatives would NOT be the result of this one reversal operation?

 

Original genome:
     (1 -5 2 6 4 -3 -8 7)

a - (1 -2 5 6 4 -3 -8 7)
b - (1 -5 2 6 4 -3 -8 -7)
c - (1 -5 -4 -6 -2 -3 -8 7)
d - (1 -5 2 3 -4 -6 -8 7)
e - None of the above. 

 

022-2015

MO640 - Multiple-choice question

Consider the following original genome:

Which of the alternatives below represents a genome which is derived from the original genome above by at most 2 reversals and no other rearrangement events?

a)





b)





c)





d)





e) None of the above.


Original idea by: Mario Akita

080-2008

MO640 - Multiple-choice question

Consider a linear chromosome π with genes numbered from 1 to 9, and disposed in the order -3, 2, -5, -6, 7, -8, 1, 4, 9, where negative signs indicate genes in the ooposite strand with respect to the others.  Which of the following signed gene orders represents chromosomes that can be obtained from π by applying a single reversal?

1. 9, 4, 1, -8, 7, -6, -5, 2, -3
2. 3, -2, 5, 6, -7, 8, -1, -4, -9
3. -3, -2, -5, -6, -7, -8, 1, 4, 9
4. -9, -4, -1, 8, 2, -5, -6, 7, 3
5. NDA

Original Idea by: Danilo Brandão Gonçalves
Translate help: Leandro José de Bortoli

021-2015

MO640 - Multiple-choice question

Given the fictitious genome G below:

Which of the following adjacency sets represents a genome that is two or less reversals apart from G?

1. {ND5_hND3_t, ND3_hCOIII_t, COIII_hND4_h, ND4_tCOI_h}
2. {ND5_hND4_t, ND4_hND3_t, ND3_hCOIII_t, COIII_hCOI_h}
3. {ND5_hND4_t, ND4_hCOIII_h, COIII_tND3_h, ND3_tCOI_h}
4. {ND5_hND4_h, ND4_tCOIII_h, COIII_tND3_h, ND3_tCOI_h}
5. None of the above.

Original idea by: Juan Felipe Hernández Albarracín.

020-2006

MO640 - Multiple-choice question

	Character
Object	c1	c2	c3	c4	c5
A	1	1	0	0	0
B	0	0	1	0	1
C	1	1	0	0	1
D	0	1	1	1	0
E	1	1	0	0	1

Given the feature matrix above, and assuming that states can transition in the direction 0 --> 1 only, we can say that:

1. It doesn't admit a perfect phylogeny, because characters c1 and c2 are not compatible.
2. It doesn't admit a perfect phylogeny, because characters c2 and c3 are not compatible.
3. It doesn't admit a perfect phylogeny, because characters c4 and c5 are not compatible. 
4. It admits a perfect phylogeny
5. None of the above

Original idea by: Mirela Dal Col Silva
Translation help by: Jessica Akemi Matsuoka

020-2015

MO640 - Multiple-choice question

Given the two fictitious linear genomes below, determine the set of adjacencies in the first genome that are not present in the second genome.

 

1) { ND1_t ND2_t , ND4_t ATP_t }

2) { COX1_tCOX2_h, COX2_t ND3_t }

3) { ND1_hND2_t , ND2_hCOX1_h , ND3_hND4L_t , ND4L_hND4_t , ND4_hATP6_h }

4) { ND1_hND2_h , ND2_tCOX1_h , ND3_hND4L_h , ND4L_tND4_h , ND4_tATP6_t }

5) None of the above

Original idea by: Leandro Tacioli

048-2005

MO640 - Multiple-choice question

Choose the WRONG alternative about genome rearreagements:

a) Rearreagement events represent the movement of large segments in a genome.
b) No rearreagement event can change the number of genes in a genome.
c) In a rearangement event, genes can be exchanged between the two strands of a DNA molecule.
d) A chromosome can be broken into two or more smaller chromosomes.
e) None of Above.

Original idea by: Leonardo Elias Mariote
Translation help by: Andrey Victor Justo

019-2015

MO640 - Multiple-choice question

Given the fictitious genome bellow, comprising two linear chromosomes, determine its adjency set:

A) { ND3h ND4Lt, ND4Lh ND4t, ND4h ND5t, ND5h ND6h, 16Sh ND1t, ND1h ND2t }

B) { ND3t ND4Lh, ND4Lt ND4h, ND4t ND5h, ND5t ND6t, 16St ND1h, ND1t ND2h }

C) { ND3h ND4Lt, ND4Lh ND4t, ND4h ND5t, ND5h ND6h, ND6t 16St, 16Sh ND1t, ND1h ND2t }

D) { ND3t ND4Lh, ND4Lt ND4h, ND4t ND5h, ND5t ND6t, ND6h 16Sh, 16St ND1h, ND1t ND2h }

E) None of the above



Original idea by: Rafael Padilha

018-2015

MO640 - Multiple-choice question

Regarding phylogeny reconstruction, which alternative is correct:

a) - The Big Phylogeny Problem is an easy problem that is usually solved with fast algorithms
b) - The Small Phylogeny Problem has the goal of finding a phylogeny that represents the  minimum amount of evolution
c) - The loss or gain of a specific character can happen just once in evolution
d) - There are two ways to root a tree: by using an outgroup or by assuming a molecular clock
e) - None of the above

Original idea by: Guilherme de Mello Barsoti

017-2015

MO640 - Multiple-choice question

Which assignment of ancestor states yields the minimum number of changes, given the topology and the species vs. characters matrix below:

Characters Species C1 C2 S1 1 1 S2 1 0 S3 0 0 S4 0 1

a)

	C1	C2
X	0	0
Y	1	1
Z	0	0

b)

	C1	C2
X	1	0
Y	1	0
Z	1	0

c)

	C1	C2
X	0	0
Y	1	0
Z	0	0

d)

	C1	C2
X	0	1
Y	1	1
Z	0	0

e) None of the above.

Original idea by: Miriam Ito

016-2015

MO640 - Multiple-choice question

Considering the following species vs. characters matrix:

What is (are) the most parsimious tree(s) among the
 three 
possible 
unrooted
 trees 
for 
four 
taxa,  
shown below?

1. Trees 2 and 3
2. Tree 1
3. Tree 3
4. Trees 1 and 3
5. None of the above

Original idea by: Shagali Huanca Vargas

015-2015

MO640 - Multiple-choice question

Considering the "Species vs. Characters" matrix below, what is the number of changes in the most parsimonious tree?

1) 8
2) 10
3) 15
4) 18
5) None of the above

Original idea by: Leandro Tacioli

014-2015

MO640 - Multiple-choice question

Given the data set and tree below, choose the right answer with respect to most parsimonious reconstructions.

1. The minimum overall state changes needed is 7.
2. The minimum overall state changes needed is 8.
3. Reconstructions of character 2 need two state changes.
4. Reconstructions of character 5 need two state changes.
5. None of the above.

Original idea by: Leandro José de Bortoli

016-2006

MO640 - Multiple-choice question

Methods that use parsimony to build phylogenetic trees aims at:

1. Find the phylogeny that has the minimum number of homoplasies.
2. Find the phylogeny that has the maximum possible number of species in the tree leaves, i.e., species that didn't originate any other species.
3. Find an unrooted phylogenetic tree.
4. Finding the phylogeny that has the minimum number of outgroups among the analyzed species.
5. None of the Above

Original Idea by: Mirela Dal Col Silva

Translation help by: Jéssica Akemi Matsuoka

016-2011

MO640 - Multiple-choice question

What is the best phylogeny for the following matrix of states and characters?

	Characters
individual	c1	c2	c3	c4	c5	c6
A	0	0	0	1	1	0
B	1	1	0	0	0	0
C	0	0	0	1	1	1
D	1	0	1	0	0	0
E	0	0	0	1	0	0

(Consider that labeled edges mean that the named character has changed state)

a)

c)

---

b)

d)

---

e) None of the above

Original idea by: Felipe Holanda

Translation help by: Cristiano Borges Cardoso

013-2015

MO640 - Multiple-choice question

Considering the Jukes-Cantor and Kimura Evolution Models and the three sequences below from a homologous DNA locus of different species, evaluate the statements:

Sequence 1: AATGATGACGTTAGGAAAACTAGACGGTACGTAGT
Sequence 2: AATAATGACGTTAGGAAAATTAGACAGTAGGCAGT
Sequence 3: AAAAATGACGTAAGGAAAATTAGACAGCAGGTAGT

(columns where mutations have been observed are in red)

 I - Considering the Jukes-Cantor Model, the distance between sequences 1 and 2 and between 2 and 3 are the same.
II - Considering the Kimura Evolution Model, the distance between 1 and 2 is different from the distance between 2 and 3.
III - The distance between 1 and 3 is greater than the distance between 1 and 2 and the distance between 2 and 3, no matter which of the two models is used.

Choose the correct alternative

a) Only statement I is correct.
b) Only statements I and II are correct.
c) Only statement III is correct.
d) Only statements II and III are correct.
e) None of the above.

Original idea by Mario Akita

012-2015

MO640 - Multiple-choice question

Consider the phylogenetic trees below.

Assume that C1, C2, C3, and C4 are all binary, unordered characters.  Which of the topologies could be a most parsimonious tree possible for a given input table?

a) I, II, and III
b) I and II only
c) I only
d) III only
e) None of the above

Original Idea by: Mario Akita

011-2006

MO640 - Multiple-choice question

What is the main difference between the Kimura model and the Jukes-Cantor model?

1) The Kimura model is used to study transitions only, while the Jukes-Cantor model is used to study transversions only.
2) The Kimura model is a recursive representation of the Jukes-Cantor model.
3) The Kimura model has a better approach than the Jukes-Cantor model, because transitions and transversions receive different probabilities.
4) Both models are used to study different subjects, so there is no ground for comparison.
5) None of the above

Original idea by: Douglas José Soares Rodrigues
Translation help by: Leandro Tacioli

044-2008

MO640 - Multiple-choice question

According to the model of DNA sequence evolution described by Kimura,
in the equation X(t) + Y(t) + 2 * Z(t) = 1, which sentence below is CORRECT?

a. Y(t) is the transition probability.
b. X(t) is the transversion probability.
c. Y(t) + 2 * Z(t) is the probability of having no changes.
d. The constant 2 multiplying Z(t) is to consider the two different transition types (i.e., A ⇆ G; C ⇆ T).
e. None of the above.

Original idea by: Helder dos Santos Ribeiro
Translation help by: Raphael Cristofaro

018-2004

MO640 - Multiple-choice question

Regarding DNA evolution models, we can say that:

1. The Jukes-Cantor model is more refined than the Kimura model, since it ignores transitions, rare in nature, and considers only transversions, which are more common mutations.
2. The Kimura model is inefficient because it has only two parameters, one for the probability of a mutation occuring, and one for the probability of the position remaining unchanged.
3. The Jukes-Cantor model is more refined than the Kimura model because it takes into consideration the variation in mutation rates in different positions along the length of the sequence.
4. The Kimura model is more refined than the Jukes-Cantor by taking into account the difference that normally exists between the transversion rate and the transition rate.
5. None of the above

Original idea by: José Augusto Amgarten Quitzau
Translate Help: Leandro José de Bortoli

019-2007

MO640 - Multiple-choice question

With respect to the Jukes-Cantor and Kimura models of DNA sequence evolution, choose the right option:

a) In molecular evolution the probability of a transition tends to be larger than the probability of a transversion.
b) The Kimura model does not consider different rates for transversions and transitions.
c) The main difference introduced by Kimura was having the same rate for different kinds of mutation.
d) The distances between two sequences, when measured using the models of Kimura and Jukes-Cantor, tend to be very different, even between almost identical sequences.
e) None of the above.

Original idea by: Luis Felipe Strano Moraes
Translation help by: Andrey Victor Justo