Saturday, March 28, 2015

010-2011

MO640 - Multiple-choice question


Consider the following sequences:  s = AACT  and  t = GAGG . If we apply the basic global alignment algorithm on these sequences, with weights match = 1, mismatch = -1 and gap = -2, where s occupies the first column and t the first row, what are the values of the last row and the last column of the matrix?


a. Row: -8,-7,-3,-2,-1 ; Column: -8,-5,-4,-3,-2
b. Row: -8,-7,-3,-2,-1 ; Column: -8,-5,-3,-2,-1
c. Row: -8,-7,-4,-3,-2 ; Column: -8,-5,-4,-3,-2
d. Row: -8,-7,-4,-3,-1 ; Column: -8,-5,-3,-2,-1
e. None of the above
 
Original idea by: Wilson Vendramel
Translation help by: Shagalí Huanca Vargas

035-2008

MO640 - Multiple-choice question


Which of the following modifications do not need to be made to the global alignment algorithm to transform it into the local alignment algorithm?

  1. Initialize with zeros the first column and the first row of the matrix.
  2. Stop the reconstruction of a local alignment as soon as a 0 is found in the matrix.
  3. Do not let the matrix values become negative; if the maximum value is negative, it should be replaced by 0.
  4. Find the highest value on the entire matrix to obtain the similarity and use its position as a starting point for reconstruction of an optimal alignment.
  5. None of the above.
Original idea by: Filipe Benevides Netto
Translation help by: Leandro José de Bortoli. 

Monday, March 23, 2015

011-2015

MO640 - Multiple-choice question

Which of the following statements is CORRECT?

a) Local alignments are most useful when we have similar sequences and need to align every residue in these sequences.
b) Global alignments identify regions of similarity within long sequences that are often widely divergent overall.
c) Dynamic programming methods like the Needleman-Wunsch and the Smith-Waterman algorithms are reasonable choices to perform large-scale database searches.
d) Unlike dynamic programming methods, k-tuple methods like FASTA and BLAST are heuristics that guarantee to find an optimal alignment.
e) None of the above.

Original idea by: Raphael Cristofaro

010-2015

MO640 - Multiple-choice question

During the sequencing of an organism, a researcher found three different base sequences for a certain region of interest, aligned as follows:

Sequence 1: AA-AGCCACGGGG-AAGCTGACGTCCA
Sequence 2: AA-AGCCA-GC-GCAAGCTGACGTCCA
Sequence 3: AATAGCCACGGGGCAAGCTGACG-CCA
Which of the alternatives below is most likely the original sequence of this region?
 
a) AA-AGCCA-GCG-CAAGCTGACGCCCA
b) AATAGCCACGGGGCAAGCTGACGTCCA
c) AAAGCCACGGGGCAAGCTGACCTCCA
d) AAAGCCAGGGAAGCTGACCTCAAA
e) None of the above
 
Original idea by: Mario Akita

009-2015

MO640 - Multiple-choice question

Consider the following alignments on DNA sequences, where matches, mismatches, and spaces are shown by '|', '.', and '-', respectively:

First Alignment:

5' ATTACCTAGATTACTTACGGATCAGGTACTTTAGAGGCTTGCTT 3' 
             |-|||.||||||.|||||||||||||||
          5' T-ACTCACGGATGAGGTACTTTAGAGGC 3'
Second Alignment:
5' ACTTCTAGATTACTTACGGATCAGGTACTTTAGAGGCTTGCAACCT 3'
   |||||||||||----|||||||--||||||||||||||.|||||||
5' ACTTCTAGATT----ACGGATC--GTACTTTAGAGGCTAGCAACCT 3'
and the following statements:

I. The first alignment is a global alignment.
II. The second alignment is both local and global.
III. The basic dynamic programming algorithm comparing two
sequences with same length n runs in time O(n²) .


Which alternative is true?

a. statements I, II, and III are correct
b. only statements I and II are correct
c. only statements I and III are correct
d. only statements II and III are correct
e. None of the above

Original idea by: Jessica Akemi Matsuoka

013-2004

MO640 - Multiple-choice question

Considering the class of interval graphs, which alternative is correct:

  1. No polynomial-time algorithm is known for deciding whether a given graph is an interval graph.
  2. Every induced subgraph of an interval graph is itself an interval graph.
  3. If an induced subgraph of a graph G is an interval graph, then G is also an interval graph.
  4. The graph C4 (cycle with 4 vertices) belongs to this class.
  5. None of the abova
Original idea by: Marília Felippe Chiozo

010-2004

MO640 - Multiple-choice question

Let G be an acyclic directed graph. The strongly connected components of G are:

  1. vertices.
  2. nontrivial trees, that is, trees with 2 or more vertices.
  3. cicles, where the edge orientations are disregarded.
  4. paths with at least one edge.
  5. None of the above
Original idea by: Cleber Valgas Gomes Mira

014-2004

MO640 - Multiple-choice question

Consider a simple, connected graph composed solely by two cycles that share exactly one vertex, in a format that resembles a bow tie. Which if the following statements is true?

  1. This graph is not Eulerian or Hamiltonian.
  2. This graph is Eulerian, but not Hamiltonian.
  3. This graph is Hamiltonian, but not Eulerian.
  4. This graph is both Eulerian and Hamiltonian.
  5. None of the above
Original idea by: José Augusto Amgarten Quitzau

013-2006

MO640 - Multiple-choice question

Consider the following statements about a string s with n distinct characters:

I. For s, there are 1 + n(n+1)/2 possible substrings.
II. For s, there are 2n possible subsequences.
III. For s, there are n + 1 possible prefixes.

  1. Only statement II is correct.
  2. Statements I and II are correct.
  3. Statements II and III are correct.
  4. Statements I and III are correct.
  5. None of the above
Original idea by: Pedro C. Feijão

Friday, March 20, 2015

008-2015

MO640 - Multiple-choice question

Which of the following is a characteristic of an NP-complete problem:

a) All NP-hard problems can be reduced to it.
b) It is known that it can be solved in polynomial time.
c) It is NOT a decision problem.
d) It can be reduced to another NP-complete problem.
e) None of the above.

Original idea by: Miriam Ito

Tuesday, March 17, 2015

012-2006

MO640 - Multiple-choice question


Regarding computational complexity problem classes, we can say that:

  1. NP problems cannot be solved in polynomial time.
  2. Any NP problem can be reduced in polynomial time to an NP-complete problem. 
  3. There is an intersection between the classes P and NP, which does not completely include any of the two.
  4. It has been proved that classes P and NP  are distinct.
  5. None of the above.
Original idea by: Tiago Rinck Caveden.
Translation help by: Leandro José de Bortoli.

Monday, March 16, 2015

010-2006

MO640 - Multiple-choice question


Two algorithms A and B solve a problem. For every input of size N,Algorithm A takes time f(N)=N², and Algorithm B takes time g(N)=aN, where a is a constant. We may conclude that: 

a) Algorithm A will always be faster than B, because A is quadratic, regardless of input size. 
b) Algorithm B will always be faster than A, because B is linear, regardless of input size. 
c) When the input size is smaller than a, the linear algorithm will be faster. 
d) When the input size is larger than a, the linear algorithm will be faster. 
e) NOTA 

Original idea by: Rodrigo Ritter.
Translation help by: Cristiano Borges Cardoso.

007-2015

MO640 - Multiple-choice question


Consider the following statements and mark the alternative listing all the FALSE statements:

I - A Hamiltonian cycle can be converted to a Hamiltonian path by removing one of its edges.
II - There is a connected graph in which a vertex has odd degree and for which we have an Eulerian cycle.
III - A cycle graph (a graph that consists of a single Eulerian and Hamiltonian cycle) that has an even number of vertices is bipartite.

a. I
b. II
c. III
d. more than one statement above is FALSE
e. None of the Above

Original idea by: Raphael Cristofaro

Sunday, March 15, 2015

006-2015

MO640 - Multiple-choice question


Which of the phrases below is correct?

A)  Both problems of (A) recognizing Hamiltonian graphs and (B) recognizing Eulerian graphs are NP - Complete problems.
B)  There aren't graphs that admit both a Hamiltonian cycle and an Eulerian tour simultaneously.
C)  Eulerian and Hamiltonian graphs are necessarily connected graphs.
D)  The Travelling Salesman Problem (TSP) is a particular case of the problem of finding a Hamiltonian cycle.
E)  None of the above

Original idea by: Roberto Hiroshi Higa
Translation help by: Rafael S. Padilha

Saturday, March 14, 2015

009-2008

MO640 - Multiple-choice question


Which alternative better represents the Central Dogma of molecular biology?

  1. DNA --> (translation) --> Proteins --> (transcription) --> RNA
  2. RNA --> (translation) --> Proteins --> (transcription) --> DNA
  3. DNA --> (translation) --> RNA --> (transcription) --> Proteins
  4. RNA --> (transcription) --> DNA --> (translation) --> Proteins
  5. None of the above
Original idea by: Filipe Benevides Netto

015-2008

MO640 - Multiple-choice question


Which alternative contains amino acids only:

  1. alanine, valine, glycine, leucine.
  2. lipase, amylase, protease, glucoamylase.
  3. keratin, mucin, hemoglobin, casein.
  4. plasmocyte, limphocyte, leukocyte, thymocyte.
  5. None of the above
Original idea by: Pedro Henrique Del Bianco Hokama

016-2008

MO640 - Multiple-choice question


Mark the item that does NOT correspond to one of the compounds linked to the main carbon atom (alpha carbon) of an amino acid:

  1. H
  2. O
  3. NH2
  4. COOH
  5. None of the above

Original idea by: Rajiv Santos

023-2008

MO640 - Multiple-choice question


In genetic engineering, expression systems are based on the insertion of a certain gene into a host cell, where it is translated yielding a protein.  Mark the item below that does NOT correspond to an advantage of using bacterial cells as hosts for expression systems:

  1. Bacteria have simple physiology
  2. High productivity, with up to 10% of the total mass.
  3. Proteins in these cells usually fold correctly.
  4. Reduced production time, since bacteria grow and multiply quickly.
  5. None of the above

Original idea by: Fabio L. Usberti

021-2005

MO640 - Multiple-choice question


How do restriction enzymes help in genome sequencing?

  1. They help decrease the time fro clone replication
  2. They are used in the PCR technique to warp up the reaction
  3. They break the genome into smaller fragments
  4. They cut the genome in fragments that code for genes
  5. None of the above
Original idea by: Daniel Piccolo Gasparotto

Saturday, March 7, 2015

005-2015

MO640 - Multiple-choice question


Codon can be defined as:

  a) Gene region not involved in protein synthesis.
  b) Location of a gene in a chromosome.
  c) Long sequence of nucleotides that translates into a protein.
  d) Sequence of nucleotides that codes for an amino acid.
  e) None of the above

Original idea by: Patrícia Pilisson Côgo
Translation help by: Ramon Maciel

004-2015

MO640 - Multiple-choice question


A diploid cell with 2n = 32 chromosomes, after meiosis, gives origin to:

a) 2 cells with 16 chromosomes each
b) 2 cells with 32 chromosomes each
c) 4 cells with 16 chromosomes each
d) 4 cells with 32 chromosomes each
e) NOTA

Original idea by: Beto Marchesini.
Translation help by: Cicero Luiz Jr.

003-2015

MO640 - Multiple-choice question


Which of these are human cell structures that contain DNA?

A - Mitochondria and Chloroplast
B - Nucleus and Chloroplast
C - Nucleus and Mitochondria
D - Nucleolus and Ribosome
E - None of the Above

Original idea by: Leandro Tacioli

002-2015

MO640 - Multiple-choice question


Which statement about RNA is false?

a) The sugar in an RNA molecule is ribose.
b) There are four kinds of bases that can be found in RNA: adenine, guanine, cytosine and thymine.
c) There are three major classes of RNA: messenger RNA, transfer RNA and ribosomal RNA.
d) The three-dimensional structure of RNA is far more varied than that of DNA.
e) None of the above.

Original idea by: Miriam Ito

001-2015

MO640 - Multiple-choice question


Which kind of nucleic acid is not used in protein synthesis?

a) - DNA
b) - rRNA
c) - mRNA
d) - tRNA
e) - none of the above

Original idea by: Guilherme de Mello Barsoti